Sequence ID | >WENV170644294 |
Genome ID | JMBW01005144 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 474 |
End posion on genome | 558 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atcccgtttt |
tRNA gene sequence |
GCGGCTGTGGCGTAATTGGTAGCCGCGCTAGACTTAGGATCTAGTGACGAGAGTCGTGGG |
Downstream region at tRNA end position |
taaagctcct |
Secondary structure (Cloverleaf model) | >WENV170644294 Leu TAG t ACat taaagctcct G - C C - G G - C G - C C - G T - A G - C T G T T T C C C A T A A G + + | | | G T T G C G G G G G G C G | | | T T G C C G C T A G G TGACGAGAGTCGTGG C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |