Sequence ID | >WENV170644298 |
Genome ID | JMBW01005171 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 321 |
End posion on genome | 411 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atggtggaat |
tRNA gene sequence |
GGAGAGGTACCGAAGCGGTCATAACGGGGCGGTCTTGAAAACCGTTGGGGTCTTATGGCC |
Downstream region at tRNA end position |
gtttttatgg |
Secondary structure (Cloverleaf model) | >WENV170644298 Ser TGA t GCCA gtttttatgg G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G C G A A | | | | | G G A G C C G T G G G C T | | | T T C A C G G A T A G TGGGGTCTTATGGCCCAC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |