Sequence ID | >WENV170644300 |
Genome ID | JMBW01005171 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 519 |
End posion on genome | 598 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccacatgggg |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTTAGAGCGCCCGGCTCATAACCGGTAGGTCCGGGGGGGTTC |
Downstream region at tRNA end position |
tgtttgccca |
Secondary structure (Cloverleaf model) | >WENV170644300 Met CAT g ACCA tgtttgccca G - C G - C G - C C - G C - G T - A T - A T G T G T C C C A T G A A + | | | G T C T C G G G G G G C G | | | | T T G G A G C T T A G AGGTCCGG C T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |