Sequence ID | >WENV170644308 |
Genome ID | JMBW01005387 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1142 |
End posion on genome | 1216 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
agcatagaaa |
tRNA gene sequence |
GGGCGCTTAGCTCAGTGGGAGAGCGTCTGCTTCACGCGCAGAAGGTCGTAGGTTCAAGTC |
Downstream region at tRNA end position |
atttcttatc |
Secondary structure (Cloverleaf model) | >WENV170644308 Val CAC a ACCA atttcttatc G - C G - C G - C C - G G - C C - G T - A T G T C A T C C A G A A | | | | | A T C T C G G T A G G C G | | | | T T G G A G C G A G AGGTC T - A C - G T - A G - C C - G T C T G C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |