Sequence ID | >WENV170644318 |
Genome ID | JMBW01005552 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 586 |
End posion on genome | 660 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttgaaaagcc |
tRNA gene sequence |
CCCCCTGTAGTTCAACGGATAGAACGGCGGATTCCTAATCCGCAAATGAAGGTTCGACTC |
Downstream region at tRNA end position |
tttattttaa |
Secondary structure (Cloverleaf model) | >WENV170644318 Arg CCT c ACTA tttattttaa C C C - G C - G C - G C - G T - A G - C T C T C T T C C A C A A A | | | | | G G C T T G G A A G G C G | | | | T T A G A A C T A G AAAT G - C C - G G - C G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |