Sequence ID | >WENV170644319 |
Genome ID | JMBW01005716 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1187 |
End posion on genome | 1277 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tatcatattc |
tRNA gene sequence |
GGAGACGTAGCCTAATTGGCTAAGGCGTCGGTCTTGAAAACCGATGGGGGGGTTACACCC |
Downstream region at tRNA end position |
tacataaact |
Secondary structure (Cloverleaf model) | >WENV170644319 Ser TGA c GCCA tacataaact G - C G - C A - T G - C A - T C - G G - C T G T C A C C C A T A A A | | | | | G T T C C G G T G G G C G | | | | T T G A G G C C T A G TGGGGGGGTTACACCCCGT T - A C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |