Sequence ID | >WENV170644320 |
Genome ID | JMBW01005761 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 210 |
End posion on genome | 139 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
atggactcac |
tRNA gene sequence |
GCGGGTGTTGCCAAGTGGTAAGGCATTAGCTTCCCAAGCTAACATTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
tcaatttcag |
Secondary structure (Cloverleaf model) | >WENV170644320 Gly CCC c Tttc tcaatttcag G - C C - G G - C G - C G - C T - A G - C T A T T A C C C A G A T + | | | | G T A C C G G T G G G C G | | | T T G A G G C T A A CATTC T - A T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |