Sequence ID | >WENV170644321 |
Genome ID | JMBW01005918 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 337 |
End posion on genome | 261 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tattagttgt |
tRNA gene sequence |
GCACCCGTAGCTCAGTAGGATAGAGCAGCGCCCTCCTAAGGCGTGTGTCGGGGGTTCGAT |
Downstream region at tRNA end position |
tatatttggt |
Secondary structure (Cloverleaf model) | >WENV170644321 Arg CCT t ACCA tatatttggt G - C C - G A - T C - G C - G C - G G - C T T T T C T C C A T G A A + | + | | G A C T C G G G G G G C G | | | | T T G G A G C A T A A GTGTC G + T C - G G - C C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |