Sequence ID | >WENV170644323 |
Genome ID | JMBW01005935 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 271 |
End posion on genome | 358 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
taattcagtc |
tRNA gene sequence |
GCGCGAGTGGCGGAACTGGCAGACGCGCAGGACTTAGAATCCTGTGGATGAATAATCCGT |
Downstream region at tRNA end position |
ctctatatat |
Secondary structure (Cloverleaf model) | >WENV170644323 Leu TAG c ACCA ctctatatat G - C C - G G - C C - G G - C A - T G - C T G T C A C C C A C A A G | | | | | A T G G C G G T G G G C G | | | T T G A C G C C A G G TGGATGAATAATCCGT C - G A - T G - C G - C A - T C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |