Sequence ID | >WENV170644327 |
Genome ID | JMBW01006454 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 1068 |
End posion on genome | 1142 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aattcctccg |
tRNA gene sequence |
GCCGGCGTAGCTCAATGGTAGAGCGGCGCACTCGTAATGCGCAGGTTGTGGGTTCGATTC |
Downstream region at tRNA end position |
agacacacgc |
Secondary structure (Cloverleaf model) | >WENV170644327 Thr CGT g TCCA agacacacgc G - C C - G C - G G - C G - C C - G G - C T T T C A C C C A A A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G AGGTT G - C C - G G - C C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |