Sequence ID | >WENV170644331 |
Genome ID | JMBW01006875 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 998 |
End posion on genome | 907 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ccagttttgt |
tRNA gene sequence |
GGAGAAGTACTCAAGTGGCTGAAGAGGCTCCCCTGCTAAGGGAGTAGGTCCTTCATTAGG |
Downstream region at tRNA end position |
ttataggggg |
Secondary structure (Cloverleaf model) | >WENV170644331 Ser GCT t GCCA ttataggggg G - C G - C A - T G - C A - T A - T G - C T A T C T C C C A T G A A | | | | | A G A C T C G A G G G C G | | | T T C A G A G T G A G TAGGTCCTTCATTAGGGCGC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |