Sequence ID | >WENV170644334 |
Genome ID | JMBW01006875 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 573 |
End posion on genome | 499 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
atgatggagg |
tRNA gene sequence |
GGGGGTGTAGTTCAGCGGTAGAACGTCGGTCTCCAAAACCGAATGTCGTGGGTTCGAGTC |
Downstream region at tRNA end position |
ttttaatgat |
Secondary structure (Cloverleaf model) | >WENV170644334 Trp CCA g GCCA ttttaatgat G + T G - C G - C G - C G - C T - A G - C T G T C G T C C A G A A | + + | | G C C T T G G T G G G C G | | | | T T G G A A C T A G ATGTC T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |