Sequence ID | >WENV170644339 |
Genome ID | JMBW01006915 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 931 |
End posion on genome | 848 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tagataataa |
tRNA gene sequence |
GGACGGTTACCCAAGTGGACAACGGGGGCTGACTGTAAATCAGCTGGCAAAGGCCTTCGG |
Downstream region at tRNA end position |
tctgatacac |
Secondary structure (Cloverleaf model) | >WENV170644339 Tyr GTA a ACtg tctgatacac G - C G - C A - T C - G G - C G - C T - A T A T C T T C C A T G A A | + | | | G G A C C C G G A G G C G | | | T T A C G G G C A A G TGGCAAAGGCCTTC G - C C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |