Sequence ID | >WENV170644346 |
Genome ID | JMBW01007067 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 880 |
End posion on genome | 789 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ataccaatca |
tRNA gene sequence |
GGAAGGGTGCTTGAGTGGCCGAAAAGAGCCGCCTGCTAAGCGGTTGAGGGTTAACCGCCC |
Downstream region at tRNA end position |
Agatacgcgc |
Secondary structure (Cloverleaf model) | >WENV170644346 Ser GCT a CGCC Agatacgcgc G - C G + T A - T A C G - C G - C G - C T A T C T C C C A T G A G | | | | | A G G T T C G A G G G C G | | | T T C A A A G C G A A TGAGGGTTAACCGCCCTCC G + T C - G C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |