Sequence ID | >WENV170644347 |
Genome ID | JMBW01007067 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 783 |
End posion on genome | 707 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cgccagatac |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTGTCTGACTACGAATCAGAAGGCCACAGGTTCGAA |
Downstream region at tRNA end position |
tgcataaaca |
Secondary structure (Cloverleaf model) | >WENV170644347 Arg ACG c GCCA tgcataaaca G - C C - G G - C C - G C - G C - G G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | + T T G G A G T A T A G AGGCC T - A C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |