Sequence ID | >WENV170644350 |
Genome ID | JMBW01007350 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 971 |
End posion on genome | 1047 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tcctaatgtt |
tRNA gene sequence |
GGTCCGGTAGCTCAGTTGGATAGAGCAGCAGCCTTCTAAGCTGCGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
ggccctgtaa |
Secondary structure (Cloverleaf model) | >WENV170644350 Arg TCT t ACAA ggccctgtaa G - C G + T T - A C - G C - G G - C G - C T A T C G C C C A T G A A | + | | | G T C T C G G T G G G C G | | | | T T G G A G C A T A A GGGTC G - C C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |