Sequence ID | >WENV170644359 |
Genome ID | JMBW01007883 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 417 |
End posion on genome | 494 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gcccggtaat |
tRNA gene sequence |
GGCCCATTCGTCTATCGGCTAGGACGCAAGATTTTCATTCTTGAAAGAGGGGGGGTTCGA |
Downstream region at tRNA end position |
ataaaaaaag |
Secondary structure (Cloverleaf model) | >WENV170644359 Glu TTC t ACTA ataaaaaaag G + T G - C C - G C - G C - G A - T T - A T T T T C C C C A C T A C + | | | | G G T C T G G G G G G C G + | | | T T C G G A C T A G AAAGAGG C - G A - T A - T G - C A - T T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |