Sequence ID | >WENV170644360 |
Genome ID | JMBW01007916 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 605 |
End posion on genome | 682 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
actttatggc |
tRNA gene sequence |
GGGGGCGTGGCGCAGTTTGGCTAGCGCGCCTGCCTTGGGAGCAGGAGGCCGGAGGTTCAA |
Downstream region at tRNA end position |
ttttttttgc |
Secondary structure (Cloverleaf model) | >WENV170644360 Pro TGG c ACCA ttttttttgc G G G - C G - C G - C G - C C - G G - C T A T T C T C C A T T G A G + | | | | A T C G C G G G A G G C G | | | | T T G G C G C C T A G AGGCC C - G C - G T - A G - C C - G C A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |