Sequence ID | >WENV170644365 |
Genome ID | JMBW01007972 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 148 |
End posion on genome | 63 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cgggtagcgg |
tRNA gene sequence |
GCCGAAGTGGCGGAACGGCAGACGCGCTGCGTTCAGGGCGCAGTGGGCGCAAGCCCGTGT |
Downstream region at tRNA end position |
aataagtatg |
Secondary structure (Cloverleaf model) | >WENV170644365 Leu CAG g ACCA aataagtatg G - C C - G C - G G - C A - T A - T G - C T A T C A C C C A C A A G | | | | | A G G G C G G T G G G C G | | | T T C A C G C A G G TGGGCGCAAGCCCGT C - G T - A G - C C - G G - C T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |