Sequence ID | >WENV170644368 |
Genome ID | JMBW01008178 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 827 |
End posion on genome | 924 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tactttgcat |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGACGAAGGCGCTCGCCTGGAAAGCGAGTAGATGGGGGGGCAAA |
Downstream region at tRNA end position |
tttttatttt |
Secondary structure (Cloverleaf model) | >WENV170644368 Ser GGA t GCCA tttttatttt G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G T C G G A G G G C G + | | T T A A G G C C G A G TAGATGGGGGGGCAAAACCTCGTCTC C - G T - A C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |