Sequence ID | >WENV170644373 |
Genome ID | JMBW01008812 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 252 |
End posion on genome | 326 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
atgttgtggg |
tRNA gene sequence |
GGGGCTGTGGCGCAGAGGGAGCGCGCTTCCTTGGCATGGAAGAGGCCGCGGGTTCAAGTC |
Downstream region at tRNA end position |
ttatttacca |
Secondary structure (Cloverleaf model) | >WENV170644373 Ala GGC g ACCA ttatttacca G - C G - C G + T G - C C - G T - A G - C T G T C G C C C A G A G | | | | | A A C G C G G C G G G C G | | | | T T G G C G C G A G AGGCC C - G T - A T - A C - G C - G T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |