Sequence ID | >WENV170644379 |
Genome ID | JMBW01009249 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 41 |
End posion on genome | 119 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gacaatgtgt |
tRNA gene sequence |
GCGCCACTAGCTCAGATGGTAGAGCGGCTGACTCTTAATCAGCAAGTCCGGGGGGGTTCG |
Downstream region at tRNA end position |
cttttttttg |
Secondary structure (Cloverleaf model) | >WENV170644379 Lys CTT t ACCA cttttttttg G + T C - G G - C C - G C - G A - T C - G T G T G C C C C A A G A A | | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G AAGTCCGG G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |