Sequence ID | >WENV170644384 |
Genome ID | JMBW01010113 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 798 |
End posion on genome | 721 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tctaagaagt |
tRNA gene sequence |
GGCCCCGTAGCTCAGTTGGATAGAGCAGCGGTTTCCTAAACCGCGTGCCGGACGTTCGAG |
Downstream region at tRNA end position |
Atatctctca |
Secondary structure (Cloverleaf model) | >WENV170644384 Arg CCT t TGCC Atatctctca G - C G G C - G C - G C - G C - G G - C T G T T C T G C A T G A A + | | | | G T C T C G G G A C G C G | | | | T T G G A G C A T A A GTGCC G - C C - G G - C G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |