Sequence ID | >WENV170644392 |
Genome ID | JMBW01010503 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 260 |
End posion on genome | 187 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tgctttctgc |
tRNA gene sequence |
GGGCGGATAGCTCAGTTGGTTAGAGCGCATCTTTTACACAGATGAGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
attttatatc |
Secondary structure (Cloverleaf model) | >WENV170644392 Val TAC c Attt attttatatc G - C G - C G - C C - G G + T G - C A - T T G T T G T C C A T G A A + | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A C - G T - A T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |