Sequence ID | >WENV170644394 |
Genome ID | JMBW01010610 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 248 |
End posion on genome | 327 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ccggttacgg |
tRNA gene sequence |
GGGGGTGTAGCGCAGTTTGGTAGCGCACGTGGTTTGGGACCATGGGGCCGGGGGGGGTTC |
Downstream region at tRNA end position |
ccatactaaa |
Secondary structure (Cloverleaf model) | >WENV170644394 Pro TGG g CCGA ccatactaaa G - C G - C G - C G - C G - C T - A G - C T A T C T C C C A T G A A | + | | | A T C G C G G G G G G C T | | | | T T G G C G C G T A A GGGCCGGG C - G G + T T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |