Sequence ID | >WENV170644408 |
Genome ID | JMBW01011112 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 686 |
End posion on genome | 763 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aataagtata |
tRNA gene sequence |
GCGTCTGTAGCTCAATTGGATAGAGCGTCGGACTTCGGATCCGAAGGCTTGTGGGTTCGA |
Downstream region at tRNA end position |
ttcagtccta |
Secondary structure (Cloverleaf model) | >WENV170644408 Arg TCG a GCCA ttcagtccta G - C C - G G - C T - A C - G T - A G - C T A T C A C C C A T A A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C A T A G AGGCTT T - A C - G G - C G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |