Sequence ID | >WENV170644416 |
Genome ID | JMBW01013273 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 728 |
End posion on genome | 802 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
acaggtaatt |
tRNA gene sequence |
GGGCGGATAGCTCAGCGGGAGAGCACCTGCCTTACACGCAGGGGGTCGCAGGTTCGAAAC |
Downstream region at tRNA end position |
aaacagtaca |
Secondary structure (Cloverleaf model) | >WENV170644416 Val TAC t ACCA aaacagtaca G - C G - C G - C C - G G - C G - C A - T A A T C G T C C A G A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |