Sequence ID | >WENV170644417 |
Genome ID | JMBW01013300 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 20 |
End posion on genome | 94 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccaattttta |
tRNA gene sequence |
GGGCCCATAGCTTAGCGGTAGAGCAGCCGGCTCATAACCGGTCGGTCCCTGGTTCAAATC |
Downstream region at tRNA end position |
tttgaatata |
Secondary structure (Cloverleaf model) | >WENV170644417 Met CAT a ACCA tttgaatata G - C G - C G - C C - G C - G C - G A - T T A T G G A C C A G A A | | | | | A C T T C G C C T G G C G + | | | T T G G A G C T A A CGGTC G + T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |