Sequence ID | >WENV170644419 |
Genome ID | JMBW01013713 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 756 |
End posion on genome | 681 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttttattatt |
tRNA gene sequence |
GGGCATTTAACTCAGTTGGTTCAGAGTGTCACCTTGACAGGGTGGAAGTCACTGGTTCGA |
Downstream region at tRNA end position |
ttttcacctt |
Secondary structure (Cloverleaf model) | >WENV170644419 Val GAC t ACat ttttcacctt G - C G - C G - C C - G A - T T - A T - A T G T T G A C C A T T G A A | | | | | G G C T C A A C T G G C G | | | | T T T G A G T T C A G AAGTC T + G C - G A - T C - G C - G T G T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |