Sequence ID | >WENV170644421 |
Genome ID | JMBW01013824 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 370 |
End posion on genome | 295 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cgcccaccat |
tRNA gene sequence |
GCGGTAGTAGCTCAATTGGTAGAGCATCGCGTTGCCATCGCGAAGGTTGCGAGTTCGAGT |
Downstream region at tRNA end position |
gttttccctc |
Secondary structure (Cloverleaf model) | >WENV170644421 Gly GCC t TCCA gttttccctc G - C C - G G - C G - C T - A A - T G - C T G T T G C T C A T A A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A AGGTT T - A C - G G - C C - G G - C T T T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |