Sequence ID | >WENV170644423 |
Genome ID | JMBW01013824 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 179 |
End posion on genome | 91 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gtttaaacac |
tRNA gene sequence |
GCGGAAGTGGCGGAATTGGCAGACGCGCAAGGTTGAGGGCCTTGTAGGAGTTATATCCTG |
Downstream region at tRNA end position |
tatatggagc |
Secondary structure (Cloverleaf model) | >WENV170644423 Leu GAG c ACCA tatatggagc G - C C - G G - C G - C A - T A - T G - C T G T T T C C C A T A A G | | | | | A T G G C G A A G G G C G | | | T T G A C G C C A G G TAGGAGTTATATCCTGT C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |