Sequence ID | >WENV170644426 |
Genome ID | JMBW01014121 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 607 |
End posion on genome | 682 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aagatactac |
tRNA gene sequence |
GCCCAGATAGCTCAGTCGGTAGAGCAGGAGACTGAAAATCTCCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
taggcggaaa |
Secondary structure (Cloverleaf model) | >WENV170644426 Phe GAA c ACCA taggcggaaa G - C C - G C - G C - G A - T G - C A - T T T T C C G C C A T G A A | | + | | G C C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C G - C A - T G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |