Sequence ID | >WENV170644444 |
Genome ID | JMBW01015886 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 567 |
End posion on genome | 492 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aaaagtaatc |
tRNA gene sequence |
GGGCGTTTAGCTCAGCTGGTTCAGAGCATCTGCCTTACAAGCAGAGGGTCGGCGGTTCGA |
Downstream region at tRNA end position |
gataatcagg |
Secondary structure (Cloverleaf model) | >WENV170644444 Val TAC c ACtt gataatcagg G - C G - C G - C C - G G - C T - A T - A T A T C T G C C A T C G A A | + | | | G G C T C G G G C G G C G | | | | T T T G A G C T C A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |