Sequence ID | >WENV170644452 |
Genome ID | JMBW01016416 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 284 |
End posion on genome | 209 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aatcaagaat |
tRNA gene sequence |
GGGGTCGTGGCGCAGTTGGGAGCGCGCTACCATGGCACGGTAGAGGTCGTGGGTTCAAGT |
Downstream region at tRNA end position |
atcgagggag |
Secondary structure (Cloverleaf model) | >WENV170644452 Ala GGC t ACCA atcgagggag G - C G - C G + T G - C T - A C - G G - C T G T T A C C C A T G A G + | | | | A T C G C G G T G G G C G | | | | T T G G C G C G A G AGGTC C - G T - A A - T C - G C - G A C T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |