Sequence ID | >WENV170644453 |
Genome ID | JMBW01016605 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 659 |
End posion on genome | 735 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttataaaat |
tRNA gene sequence |
GGCGAGATAGCTCAGGTGGTCAGAGCGCAGCACTCATAATGCTGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644453 Met CAT t ACTA nnnnnnnnnn G + T G - C C - G G - C A - T G - C A - T C G T C T C C C A G G A A | | | | | G T C T C G G A G G G C G | | | | T T G G A G C T C A G AGGTC C - G A - T G - C C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |