Sequence ID | >WENV170644455 |
Genome ID | JMBW01016850 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 63 |
End posion on genome | 139 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tgtaaaatat |
tRNA gene sequence |
GCACCTGTAGCTCAATTGGATAGAGCACTTGACTTCGGATCAAGGCGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
ttcatcaaaa |
Secondary structure (Cloverleaf model) | >WENV170644455 Arg TCG t ACCA ttcatcaaaa G - C C - G A - T C - G C - G T - A G - C T A T T C T C C A T A A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GCGTT C - G T - A T - A G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |