Sequence ID | >WENV170644458 |
Genome ID | JMBW01017248 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 147 |
End posion on genome | 72 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
caccattaaa |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGGAGAGCGCCTGCCTTACAAGCAGGATGTCGGCAGTTCAAGT |
Downstream region at tRNA end position |
gaaatgtctt |
Secondary structure (Cloverleaf model) | >WENV170644458 Val TAC a ACCA gaaatgtctt G - C G - C G - C C - G G - C A - T T - A T G T C T G T C A T G A A | + | | | A T C T C G G G C A G C G | | | | T T G G A G C G A G ATGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |