Sequence ID | >WENV170644460 |
Genome ID | JMBW01017406 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 274 |
End posion on genome | 197 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
taaattatat |
tRNA gene sequence |
AGTCCCGTAGCTCAGTTGGTTAGAGCACTACACTGATAATGTAGGGGGGGTCGGCAGTTC |
Downstream region at tRNA end position |
tatttcgttt |
Secondary structure (Cloverleaf model) | >WENV170644460 Ile GAT t ACat tatttcgttt A - T G - C T - A C - G C - G C - G G - C T C T C C G T C A T G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T T A A GGGGGGTC C - G T - A A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |