Sequence ID | >WENV170644461 |
Genome ID | JMBW01017406 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 180 |
End posion on genome | 106 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tcgttttggg |
tRNA gene sequence |
GGGGAATTAGCTCAGTTGGCTAGAGCGCTAGATTTGCATTCTAGAGGTCAAGGGTTCGAC |
Downstream region at tRNA end position |
tctgtctttt |
Secondary structure (Cloverleaf model) | >WENV170644461 Ala TGC g ACac tctgtctttt G - C G - C G + T G - C A - T A - T T - A T C T T T C C C A T G A A | | | | | G T C T C G A A G G G C G | | | | T T G G A G C C T A G AGGTC C - G T - A A - T G - C A - T T T T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |