Sequence ID | >WENV170644464 |
Genome ID | JMBW01017554 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 111 |
End posion on genome | 35 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
atataacaat |
tRNA gene sequence |
GGCAACGTAGCCAAGGGGCCTAAGGCGGCGGTCTGCAAAATCGCTATTCGAGGGTTCAAA |
Downstream region at tRNA end position |
tatttataaa |
Secondary structure (Cloverleaf model) | >WENV170644464 Cys GCA t TCCA tatttataaa G - C G - C C - G A - T A - T C - G G - C T A T C T C C C A G G A A | | | | | A G A C C G G A G G G C G | | | T T C A G G C C T A G TATTC G - C C - G G - C G + T T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |