Sequence ID | >WENV170644487 |
Genome ID | JMBW01019023 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 34 |
End posion on genome | 110 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tccaggtcgg |
tRNA gene sequence |
GGGGGCATGGCGCAGGTTGGTAGCGCGCTTGGTTCGGGACTAAGAGGTCGGCGGTTCAAG |
Downstream region at tRNA end position |
gttaaacaag |
Secondary structure (Cloverleaf model) | >WENV170644487 Pro CGG g ACCA gttaaacaag G G G - C G - C G - C G - C C - G A - T T G T C C G C C A G G A G | | | | | A T C G C G G G C G G C T | | | | T T G G C G C G T A G AGGTC C - G T - A T - A G + T G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |