Sequence ID | >WENV170644489 |
Genome ID | JMBW01019207 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 575 |
End posion on genome | 659 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggaaaataat |
tRNA gene sequence |
GGACAGTTACCCAAGTGGCCAACGGGGGGCTGACTGTAAATCAGCTGGCAAGCGCCTTCG |
Downstream region at tRNA end position |
tctcccgcat |
Secondary structure (Cloverleaf model) | >WENV170644489 Tyr GTA t ACtt tctcccgcat G - C G - C A - T C - G A - T G - C T - A T A T C T T C C A G T G A A | + | | | G G A C C C G G A G G C C | | | T T C G G G G A A C G TGGCAAGCGCCTTC G - C C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |