Sequence ID | >WENV170644492 |
Genome ID | JMBW01019809 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 461 |
End posion on genome | 376 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttggctctat |
tRNA gene sequence |
GGAGGGATGGCCGAGCGGCCGAAGGCGCCTGTCTTGAAAACAGGTATAGGGAAACCTATC |
Downstream region at tRNA end position |
gccatagcgc |
Secondary structure (Cloverleaf model) | >WENV170644492 Ser TGA t GCtg gccatagcgc G - C G - C A - T G - C G - C G + T A - T T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T C A G G C C G A G TATAGGGAAACCTATC C - G C - G T - A G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |