Sequence ID | >WENV170644496 |
Genome ID | JMBW01019944 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 175 |
End posion on genome | 248 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttagtatggg |
tRNA gene sequence |
GGGGTGCTAGCTCATCAGGTTAGAGCAACTGCCTTTTAAGCAGTTGGTGCTGGGTTCGAG |
Downstream region at tRNA end position |
taaacattat |
Secondary structure (Cloverleaf model) | >WENV170644496 Lys TTT g Attt taaacattat G - C G + T G - C G - C T - A G - C C - G T G T G A C C C A C T A A | | | | | G A C T C G C T G G G C G | | | | T T G G A G C T T A A TGGTG A - T C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |