Sequence ID | >WENV170644497 |
Genome ID | JMBW01020257 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 526 |
End posion on genome | 601 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ctgacacttt |
tRNA gene sequence |
GGGCGCTTAGCTCAGTTGGTTAGAGCGCACGGTTCACATCCGTGAGGTTCGGAGGTTCGA |
Downstream region at tRNA end position |
ttaggccgaa |
Secondary structure (Cloverleaf model) | >WENV170644497 Val CAC t ACac ttaggccgaa G - C G - C G - C C - G G - C C - G T - A T G T T C T C C A T G A A + | | | | G T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTTC C - G A - T C - G G - C G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |