Sequence ID | >WENV170644499 |
Genome ID | JMBW01021457 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 74 |
End posion on genome | 156 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgcccgaggg |
tRNA gene sequence |
GGGGAAGTGCTGGAATTGGCAGACAGGCATGACTTAGGATCATGTGCGGAGACGCGTGAG |
Downstream region at tRNA end position |
ctaataaagt |
Secondary structure (Cloverleaf model) | >WENV170644499 Leu TAG g ACtt ctaataaagt G - C G - C G - C G - C A - T A - T G + T C G T C T C C C A T A A G | | | | | G T G G T C G A G G G C G | | | T T G A C A G C A G G TGCGGAGACGCGT C - G A - T T - A G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |