Sequence ID | >WENV170644502 |
Genome ID | JMBW01021516 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 190 |
End posion on genome | 282 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tatactatat |
tRNA gene sequence |
GGAGGATTACCCAAGTCCGGCTGAAGGGATCGGTCTTGAAAACCGACAGGTGGTTAACGC |
Downstream region at tRNA end position |
accattatcg |
Secondary structure (Cloverleaf model) | >WENV170644502 Ser TGA t Ttat accattatcg G - C G - C A - T G - C G - C A - T T - A T A T C T C C C A C T G A A | + | | | A C A C C C G G G G G C G | | | T T G A G G G C T G A A CAGGTGGTTAACGCCACGCGGG T - A C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |