Sequence ID | >WENV170644508 |
Genome ID | JMBW01022120 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 452 |
End posion on genome | 380 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aacattatac |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGGAGAGCGCTACGCTGGCAGCGTAGAGGTCGTCGGTTCAAGC |
Downstream region at tRNA end position |
gattagacaa |
Secondary structure (Cloverleaf model) | >WENV170644508 Ala GGC c Attt gattagacaa G - C G - C G + T G - C G + T T - A A - T C G T C T G C C A T G A A | | | | A T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |