Sequence ID | >WENV170644514 |
Genome ID | JMBW01022624 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 85 |
End posion on genome | 2 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agcagtacgt |
tRNA gene sequence |
GCGAGAGTGGCGGAACGGCAGACGCATCAGACTTAGGATCTGACGGGTAAAACCGTGAGG |
Downstream region at tRNA end position |
tnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644514 Leu TAG t ACCA tnnnnnnnnn G - C C - G G - C A - T G - C A - T G - C T A T C T C C C A C A A G | | | | | A G G G C G G A G G G C G | | | T T C A C G C A G A CGGGTAAAACCGT T - A C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |