Sequence ID | >WENV170644515 |
Genome ID | JMBW01022708 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 176 |
End posion on genome | 252 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
agcagtgatt |
tRNA gene sequence |
GCCCATGTGGCTCAGGAGGTTAGAGCATCGCCTTGGTAAGGCGGAGATCGGCGGTTCGAA |
Downstream region at tRNA end position |
atttatttgc |
Secondary structure (Cloverleaf model) | >WENV170644515 Thr GGT t TCCA atttatttgc G - C C - G C - G C - G A - T T - A G - C T A T C C G C C A G G A G | | | | | G A C T C G G G C G G C G | | | | T T G G A G C T T A A AGATC T + G C - G G - C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |